If you have been reading about Peptide mapping and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2025-09-17. Numbers and descriptions here follow the published literature rather than marketing material.
Semaglutide is a synthetic peptide analog of glucagon-like peptide-1, a hormone released from intestinal L-cells after food intake. It contains 31 amino acids and differs from native GLP-1 through modifications that slow enzymatic breakdown. The peptide was developed to extend the short circulating half-life of endogenous GLP-1, which is measured in minutes. Researchers introduced the compound in the early 2010s. Two backbone changes and a fatty acid side chain define its structure, distinguishing it from earlier GLP-1 receptor agonists.
The compound binds the GLP-1 receptor on pancreatic beta cells and other tissues, activating a G-protein signaling cascade that raises intracellular cyclic AMP. This action increases glucose-dependent insulin secretion when blood glucose is elevated, while binding also slows gastric emptying and reduces glucagon release. In the central nervous system, receptor activation in the hypothalamus and brainstem contributes to reduced appetite. The fatty acid chain binds albumin, which protects the peptide from renal filtration and enzymatic degradation. This albumin binding is central to its extended circulation time.
Native GLP-1 is degraded rapidly by dipeptidyl peptidase-4. Semaglutide resists this cleavage because alanine at position 8 is replaced by alpha-aminoisobutyric acid. A second substitution at position 34 introduces arginine, which further stabilizes the peptide. The most distinctive modification is a spacer and C18 fatty diacid attached at lysine 26, enabling strong albumin affinity. These three changes together produce a half-life measured in days rather than minutes, and the same structural logic underlies other long-acting analogs in this class.
Lyophilised material appears as a white to off-white cake or powder that is hygroscopic, and containers are usually equilibrated to room temperature before opening to limit condensation. Dissolution is performed in water, phosphate-buffered saline, or a mildly alkaline buffer, since solubility rises above neutral pH. Gentle inversion or low-speed mixing is preferred, because vigorous vortexing can promote surface denaturation and aggregation. Complete dissolution may require several minutes, and brief sonication is sometimes applied. Passing the solution through a 0.22 micrometre membrane removes particulates but does not by itself sterilise the liquid.
Storage at minus 20 degrees Celsius or lower in a desiccated container preserves the peptide for extended periods, while working solutions are commonly held at two to eight degrees Celsius for short intervals. Light exposure and repeated freeze-thaw cycles accelerate degradation, so dividing material into single-use aliquots is generally recommended. Adsorption to glass and plastic surfaces can lower the measured concentration of dilute solutions, particularly below one milligram per millilitre. The degradation routes most often reported for GLP-1 analogues are deamidation, methionine oxidation, and backbone hydrolysis. Relative rates under specific conditions are frequently described only for individual formulations.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide | 31 amino acids |
| Backbone modification | Aib at position 8 | Blocks DPP-4 cleavage |
| Fatty acid chain | C18 diacid | Supports albumin binding |
| Native half-life | 1 to 2 minutes | Endogenous GLP-1 |
| Analog half-life | Approximately one week | Extended by albumin binding |
Peptides are sensitive to temperature, light, oxygen, and repeated freeze-thaw cycles. Semaglutide in dry form is generally held at refrigerated temperatures, while reconstituted solutions require a defined short-term storage window. Vials should be kept in secondary packaging to limit photodegradation, and exposure to alkaline conditions is avoided because it accelerates chemical degradation. Adsorption to glass and some plastics can reduce the measured concentration of dilute solutions, so low-binding polypropylene containers are preferred for analytical work. Each transfer step introduces a small risk of contamination, and closed handling practices reduce that risk.
Routine characterisation of the peptide relies on reversed-phase high-performance liquid chromatography, often paired with ultraviolet detection near 214 nanometres. Related substances such as deamidated, oxidised, and truncated sequences elute at characteristic positions and are quantified by area percentage. Electrospray ionisation mass spectrometry confirms the molecular mass and can resolve some closely related variants. Peptide mapping after enzymatic digestion provides sequence-level verification and is useful when a full identity profile is required. Method parameters such as column chemistry, gradient, and mobile-phase pH influence the separation and must be reported alongside results.
Pharmacological activity arises from agonism at the glucagon-like peptide-1 receptor, a G protein-coupled receptor expressed in the pancreas, the gastrointestinal tract, and the brainstem. Receptor activation raises intracellular cyclic adenosine monophosphate and enhances insulin release in a glucose-dependent manner, an effect that diminishes when blood glucose concentration is low. Other effects include slowed gastric emptying and hypothalamic satiety signalling. These pathways are described well. Receptor desensitisation rates across tissues, relative to the endogenous hormone, are still under investigation, and reported findings differ between laboratories.
The company that developed the compound filed it as a long-acting analogue, and it gained first approval in 2017 for type 2 diabetes. Later authorisations from several regulators extended the indication to chronic weight management, and the World Health Organization added the glucagon-like peptide-1 receptor agonist drug class to its model list of essential medicines in 2023. Production uses solid-phase peptide synthesis followed by side-chain conjugation and chromatographic purification. Supply constraints and cost differences across regions are well documented. Literature on long-term outcomes continues to grow, with many trials reporting surrogate endpoints rather than hard clinical endpoints.
Lyophilized peptide material is typically stored at or below -20 °C, with -80 °C used for longer-term archives. Vials should remain sealed and desiccated because moisture promotes aggregation and hydrolysis. Repeated freeze-thaw cycles are avoided since they can alter peptide conformation and reduce recovery. Once reconstituted, solutions are generally kept at 2-8 °C and used within a defined window. Stability beyond those windows depends on buffer composition and concentration, and exact limits are product-specific rather than universal.
Identity and purity are assessed with reversed-phase high-performance liquid chromatography, which separates the peptide from related impurities by hydrophobicity. Mass spectrometry confirms molecular weight and detects truncation or modification products. Peptide mapping after enzymatic digestion verifies the amino acid sequence. Quantitation is often performed by LC-MS/MS or by immunoassay, and the two approaches can give different values because they measure different things. Method validation parameters such as accuracy, precision, and limit of quantitation are reported alongside results.
Certificate of analysis documents from suppliers typically report purity by chromatographic area, water content, and counter-ion identity. Independent verification is advisable because reported values can be generated under differing conditions. Impurity profiles matter for research use, where aggregates, deamidation products, and residual solvents may influence experimental results. Container, lot, and chain-of-custody records support traceability. Analytical results are method-dependent, so comparisons between laboratories require the same procedure and reference standards.
=== Biosynthetic pathway === The metabolic pathway to produce ergothioneine starts with the methylation of histidine to produce histidine betaine (hercynine). The sulfur atom is then incorporated from cysteine. The biosynthetic genes of ergothioneine have been described in detail for Mycobacterium smegmatis, Neurospora crassa, Schizosaccharomyces pombe (with homologues in Aspergillus, a genus important in food fermentation), and Caldithrix abyssi. This pathway has recently also been discovered in plants. Different groups of organisms use different approaches to sulfur-addition. Aerobic bacteria and fungi use an O2-dependent reaction that is catalyzed by a mononuclear non-heme iron enzyme, with cysteine or γ-glutamylcysteine as the sulfur source. Green sulfur bacteria and some archaea use a rhodanese-like sulfur transferase to perform oxidative polar substitution. Caldithrix uses a metallopterin-dependent bifunctional enzyme that combines an N-terminal domain similar to a tungsten-dependent acetylene hydratase and a C-terminal cysteine desulfurase domain. Homologs of the Caldithrix system are found in anaerobic bacteria and some archaea.
== Structure and properties == Because of slow rotation about the N-C(O) bond, NMF exists as two rotamers that can be distinguished by NMR spectroscopy. The two principal resonance structures for one of these rotamers is shown:
a DNA template that contains the DNA target region to amplify a DNA polymerase; an enzyme that polymerizes new DNA strands; heat-resistant Taq polymerase is especially common, as it is more likely to remain intact during the high-temperature DNA denaturation process. Pfu polymerase is a heat-resistant polymerase with higher accuracy compared to Taq due to its ability to proofread, but it runs slower. Adding a small amount of Pfu to Taq combines the benefits of both.
Sources: en.wikipedia.org
The four substrates of this enzyme are 4-hydroxybenzoic acid, reduced nicotinamide adenine dinucleotide (NADH), oxygen, and a proton. Its products are protocatechuic acid, oxidised NAD+, and water. Nicotinamide adenine dinucleotide phosphate can be used as an alternative cofactor. The enzyme is a flavin-containing monooxygenase that uses molecular oxygen as oxidant and incorporates one of its atoms into the starting material. The systematic name of this enzyme class is 4-hydroxybenzoate,NAD(P)H:oxygen oxidoreductase (3-hydroxylating). Other names in common use include 4-hydroxybenzoate 3-monooxygenase (reduced nicotinamide adenine, dinucleotide (phosphate)), 4-hydroxybenzoate-3-hydroxylase, and 4-hydroxybenzoate 3-hydroxylase. This enzyme participates in benzoate degradation via hydroxylation and also uses flavin adenine dinucleotide as a cofactor.
== Awards & Sponsorship == In 2011 IBA was granted multiple local innovation awards, e.g. for its Streptamer technology, which allows reversible isolation and staining of antigen-specific T cells. Additionally, a diagnostic test developed by IBA and Fassisi for veterinary diseases was chosen as one of the top five innovations by the county of Göttingen in 2015. Furthermore, the company honors young scientists and participated in research consortia as well.
==== Forensic applications ==== The GC-EI-MS is also used in forensic science. One example is the analysis of five local anesthetics in blood using headspace solid-phase microextraction (HS-SPME) and gas chromatography–mass spectrometry–electron impact ionization selected ion monitoring (GC–MS–EI-SIM). Local anesthesia is widely used but sometimes these drugs can cause medical accidents. In such cases an accurate, simple, and rapid method for the analysis of local anesthetics is required. GC-EI-MS was used in one case with an analysis time of 65 minutes and a sample size of approximately 0.2 g, a relatively small amount. Another application in forensic practice is the determination of date rape drugs (DRDs) in urine. These drugs are used to incapacitate victims and then rape or rob them. The analyses of these drugs are difficult due to the low concentrations in the body fluids and often a long time delay between the event and clinical examination. However, using GC-EI-MS allows a simple, sensitive and robust method for the identification, detection and quantification of 128 compounds of DRDs in urine.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
== Pharmacology == Setmelanotide binds to and activates MC4 receptors in the paraventricular nucleus (PVN) of the hypothalamus and in the lateral hypothalamic area (LHA), areas involved in the regulation of appetite, and this action is thought to underlie its appetite suppressant effects. In addition to reducing appetite, setmelanotide increases resting energy expenditure in both obese animals and humans. Importantly, unlike certain other MC4 receptor agonists, such as LY-2112688, setmelanotide has not been found to produce increases in heart rate or blood pressure. Setmelanotide has been reported to possess the following activity profile (cAMP, EC50): MC4 (0.27 nM) > MC3 (5.3 nM) ≈ MC1 (5.8 nM) > MC5 (1600 nM) ≟ MC2 (>1000 nM). (19.6-fold selectivity for MC4 over MC3, the second target of highest activity.)
=== Brush type columns (Pirkle Type) === The brush type, or Pirkle type chiral stationary phases are also called π-π Donnor-Acceptor columns. According to some theoretical models separation on these CSPs are based on a three-point attachment between the solute and the bonded chiral ligand on the surface of the stationary phase. These interactions may be attractive or repulsive in nature, depending on the mutual properties. Pirkle columns discriminate enantiomers by binding of one enantiomer with the chiral stationary phase, thereby forming a diastereomeric complex through π-π bonding, hydrogen bonding, steric interactions, and/or dipole stacking. Pirkle CSP can be categorized into three classes: (i) π-electron acceptor (ii) π-electron donor (iii) π-electron donor-π-electron acceptor.
Adalia Rose Williams, born December 10, 2006, was an American girl with progeria, who was a notable YouTuber and vlogger who shared her everyday life on social media. She died on January 12, 2022, at the age of 15. Amy Foose, born September 12, 1969, was an American girl with progeria, who died at the age of 16 on December 19, 1985. She was the sister of American automobile designer, artist, and TV star Chip Foose, who started a foundation in her name called Amy's Depot. The Progeria Research Foundation gives out The Amy Award every few years, in honor of Amy. Sammy Basso, born December 1, 1995, was an Italian biologist, activist and writer who studied progeria and campaigned to raise awareness of the disease; he died at the age of 28 on October 5, 2024. At the time of his death he was the longest-living survivor of the condition. Tiffany Wedekind, an internet influencer from Columbus, Ohio known as Tenacious Tiffany, is currently the oldest living person with progeria at 49. She also designs clothes, does yoga, involved in public speaking, amongst other things. She credits her positive attitude towards her longevity with the disease. She was also featured on TLC's show One Day In My Body.
Sources: en.wikipedia.org
It is a synthetic analog of GLP-1 produced through medicinal chemistry to resist enzymatic degradation. The design goal was longer circulation than the native hormone.
A fatty acid side chain attaches the peptide to serum albumin, which shields it from kidney filtration and protease activity. This interaction is the main reason its circulation time is extended.
No. The native hormone is GLP-1, and semaglutide is an engineered variant with three deliberate structural alterations. It does not appear in unmodified biological sources.
Filtering removes particulate matter that can block columns or scatter light. A 0.22 micrometre membrane is typical, and the filter material should be checked for peptide adsorption.